Transcript: Human XM_011541589.3

PREDICTED: Homo sapiens phospholipase A2 group V (PLA2G5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLA2G5 (5322)
Length:
1779
CDS:
865..1281

Additional Resources:

NCBI RefSeq record:
XM_011541589.3
NBCI Gene record:
PLA2G5 (5322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051329 TCGCACACAGTCCTACAAATA pLKO.1 1107 CDS 100% 13.200 18.480 N PLA2G5 n/a
2 TRCN0000051331 CAACCCACAGTACCAATACTT pLKO.1 1239 CDS 100% 5.625 7.875 N PLA2G5 n/a
3 TRCN0000051332 CCTACAAATACAGATTCGCGT pLKO.1 1118 CDS 100% 0.660 0.924 N PLA2G5 n/a
4 TRCN0000373218 ATCTGGTGTATGGGTATTAAA pLKO_005 1709 3UTR 100% 15.000 10.500 N PLA2G5 n/a
5 TRCN0000373219 AGGAGGCTTGCTGGACCTAAA pLKO_005 921 CDS 100% 10.800 7.560 N PLA2G5 n/a
6 TRCN0000051328 CCTGACAAACTACGGCTTCTA pLKO.1 975 CDS 100% 4.950 3.465 N PLA2G5 n/a
7 TRCN0000051330 CAAGAGAAACCTACGGAGCTA pLKO.1 1218 CDS 100% 2.640 1.848 N PLA2G5 n/a
8 TRCN0000378953 TACGCAAGAAGAGCCAAATTG pLKO_005 1679 3UTR 100% 13.200 7.920 N PLA2G5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01214 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01214 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480843 TCTAGTCAGAAGACCTATAGCCAG pLX_317 66.1% 100% 100% V5 n/a
Download CSV