Transcript: Human XM_011541882.1

PREDICTED: Homo sapiens interleukin 22 receptor subunit alpha 1 (IL22RA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL22RA1 (58985)
Length:
2911
CDS:
561..1877

Additional Resources:

NCBI RefSeq record:
XM_011541882.1
NBCI Gene record:
IL22RA1 (58985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422467 GGACACTTTCTAGTCCTAAAC pLKO_005 1402 CDS 100% 10.800 15.120 N IL22RA1 n/a
2 TRCN0000058941 CTGTCCGAGATCACCTACTTA pLKO.1 1113 CDS 100% 5.625 7.875 N IL22RA1 n/a
3 TRCN0000419356 AGGGACACCACAGTACCTAAA pLKO_005 1610 CDS 100% 10.800 8.640 N IL22RA1 n/a
4 TRCN0000058940 CGAAGCTCAATTCCCATTCTA pLKO.1 1262 CDS 100% 5.625 3.938 N IL22RA1 n/a
5 TRCN0000058939 CCTAAAGGTCAGCTTCAGAAA pLKO.1 1431 CDS 100% 4.950 3.465 N IL22RA1 n/a
6 TRCN0000058938 GCAGAGAGAATATGAGTTCTT pLKO.1 698 CDS 100% 4.950 3.465 N IL22RA1 n/a
7 TRCN0000058942 CGTGAAATTCCAGTCCAGCAA pLKO.1 178 5UTR 100% 2.640 1.848 N IL22RA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08783 pDONR223 100% 76.1% 76.3% None 0_1ins408;27A>C;528C>T n/a
2 ccsbBroad304_08783 pLX_304 0% 76.1% 76.3% V5 0_1ins408;27A>C;528C>T n/a
3 TRCN0000476295 ACGGACGCTTTTCTTTGTCTCGTC pLX_317 14.8% 76.1% 76.3% V5 0_1ins408;27A>C;528C>T n/a
Download CSV