Transcript: Human XM_011541951.3

PREDICTED: Homo sapiens serine and arginine rich splicing factor 4 (SRSF4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRSF4 (6429)
Length:
2208
CDS:
147..1541

Additional Resources:

NCBI RefSeq record:
XM_011541951.3
NBCI Gene record:
SRSF4 (6429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006626 CGCACAGAGTACAGACTTATT pLKO.1 447 CDS 100% 13.200 18.480 N SRSF4 n/a
2 TRCN0000231449 GACGCAGTGGATATGGTTATA pLKO_005 391 CDS 100% 13.200 18.480 N SRSF4 n/a
3 TRCN0000231448 CTTTGTGGTGAGCGAGTAATT pLKO_005 324 CDS 100% 13.200 10.560 N SRSF4 n/a
4 TRCN0000006625 GCACAAGTGATTGGAGTAGAA pLKO.1 1602 3UTR 100% 4.950 3.960 N SRSF4 n/a
5 TRCN0000006628 GCTCCAGATCAAAGTCAGCTT pLKO.1 1432 CDS 100% 2.640 2.112 N SRSF4 n/a
6 TRCN0000231451 CCCTAATGGTGTGTCTATAAT pLKO_005 1650 3UTR 100% 15.000 10.500 N SRSF4 n/a
7 TRCN0000231450 CAAGACCTAAAGGATTATATG pLKO_005 498 CDS 100% 13.200 9.240 N SRSF4 n/a
8 TRCN0000231447 GTGGATCTGAAGAACGGATAT pLKO_005 237 CDS 100% 10.800 7.560 N SRSF4 n/a
9 TRCN0000006629 GCAGTGGATATGGTTATAGAA pLKO.1 394 CDS 100% 5.625 3.938 N SRSF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01523 pDONR223 100% 93.9% 93.9% None 576_577ins90 n/a
2 ccsbBroad304_01523 pLX_304 0% 93.9% 93.9% V5 576_577ins90 n/a
3 TRCN0000481291 ACGCTTAGAATAAATTACATATGA pLX_317 31.7% 93.9% 93.9% V5 576_577ins90 n/a
Download CSV