Transcript: Human XM_011542006.1

PREDICTED: Homo sapiens NAD kinase (NADK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NADK (65220)
Length:
3111
CDS:
408..1439

Additional Resources:

NCBI RefSeq record:
XM_011542006.1
NBCI Gene record:
NADK (65220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194792 CGCAAATCAGTCGGTTGAAAT pLKO.1 1745 3UTR 100% 13.200 18.480 N NADK n/a
2 TRCN0000037700 CGATGAGACCTGGAGTTACAA pLKO.1 288 5UTR 100% 5.625 7.875 N NADK n/a
3 TRCN0000199808 GCATTGGAACGTCCGGAAGAA pLKO.1 1373 CDS 100% 4.950 6.930 N NADK n/a
4 TRCN0000197097 GCTAGTGATCGTGATCCCTTT pLKO.1 2331 3UTR 100% 4.050 5.670 N NADK n/a
5 TRCN0000199040 CGTGAGCGACTGGTTTGAGAG pLKO.1 1337 CDS 100% 1.350 1.890 N NADK n/a
6 TRCN0000230043 TGCAGTACCAGGTCCTGAATG pLKO_005 931 CDS 100% 10.800 7.560 N NADK n/a
7 TRCN0000196568 GATGACATTTCCAATCAGATA pLKO.1 603 CDS 100% 4.950 3.465 N NADK n/a
8 TRCN0000037702 GCATCAGCATCACTACCTCAT pLKO.1 1282 CDS 100% 4.050 2.835 N NADK n/a
9 TRCN0000196721 GAATAAGGAATTGAGTCCAGA pLKO.1 234 5UTR 100% 2.640 1.848 N NADK n/a
10 TRCN0000037703 GAGAACTTTCAGTCCCAAGTT pLKO.1 750 CDS 100% 0.495 0.347 N NADK n/a
11 TRCN0000230044 TGCTCCCAGGAAGGTAGTTTA pLKO_005 2094 3UTR 100% 13.200 7.920 N NADK n/a
12 TRCN0000218412 CATTCAGCTTTGAGAACTTTC pLKO_005 739 CDS 100% 10.800 6.480 N NADK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08892 pDONR223 100% 76.8% 63.2% None 0_1ins203;188_189ins106;477C>A n/a
2 ccsbBroad304_08892 pLX_304 0% 76.8% 63.2% V5 0_1ins203;188_189ins106;477C>A n/a
3 TRCN0000471738 TACAGAGCCGCCAGAGATGGGTGG pLX_317 2.2% 76.8% 63.2% V5 0_1ins203;188_189ins106;477C>A n/a
4 ccsbBroadEn_15141 pDONR223 0% 76.8% 63.2% None 0_1ins203;188_189ins106;477C>A n/a
5 ccsbBroad304_15141 pLX_304 0% 76.8% 63.2% V5 0_1ins203;188_189ins106;477C>A n/a
6 TRCN0000474095 TAATGCGGTTTCATTAGCGCGCCT pLX_317 33.7% 76.8% 63.2% V5 0_1ins203;188_189ins106;477C>A n/a
Download CSV