Transcript: Human XM_011542065.2

PREDICTED: Homo sapiens thyroid stimulating hormone subunit beta (TSHB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSHB (7252)
Length:
2202
CDS:
78..494

Additional Resources:

NCBI RefSeq record:
XM_011542065.2
NBCI Gene record:
TSHB (7252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078040 CCACCATCTGTGCTGGATATT pLKO.1 208 CDS 100% 13.200 9.240 N TSHB n/a
2 TRCN0000078038 CCCAGGATGTTTGCACATATA pLKO.1 280 CDS 100% 13.200 9.240 N TSHB n/a
3 TRCN0000078039 GCAAGTGCAATACTGACTATA pLKO.1 394 CDS 100% 13.200 9.240 N TSHB n/a
4 TRCN0000424080 ATATCAATGGCAAACTGTTTC pLKO_005 241 CDS 100% 10.800 7.560 N TSHB n/a
5 TRCN0000434873 ATTCCAACTGAGTATACAATG pLKO_005 144 CDS 100% 10.800 7.560 N TSHB n/a
6 TRCN0000078041 CACTCCATGTTGCTCCCTATT pLKO.1 340 CDS 100% 10.800 7.560 N TSHB n/a
7 TRCN0000415044 GACTGTAGAAATACCAGGATG pLKO_005 317 CDS 100% 4.050 2.835 N TSHB n/a
8 TRCN0000429121 TACATGTGGGCAAGCGATGTC pLKO_005 116 CDS 100% 4.050 2.835 N TSHB n/a
9 TRCN0000078042 CCTAACCATCAACACCACCAT pLKO.1 194 CDS 100% 2.640 1.848 N TSHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07103 pDONR223 100% 99.7% 99.2% None 40A>G n/a
2 ccsbBroad304_07103 pLX_304 0% 99.7% 99.2% V5 40A>G n/a
3 TRCN0000467439 CGCAATAACCGCTACCACTGAGTG pLX_317 90.3% 99.7% 99.2% V5 40A>G n/a
Download CSV