Transcript: Human XM_011542088.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 17 (ZBTB17), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB17 (7709)
Length:
2718
CDS:
453..2618

Additional Resources:

NCBI RefSeq record:
XM_011542088.1
NBCI Gene record:
ZBTB17 (7709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235730 TGTCCAAGCACATCATCATTC pLKO_005 2008 CDS 100% 10.800 15.120 N ZBTB17 n/a
2 TRCN0000012954 GTGTTCACTTTAAGGCTCATA pLKO.1 279 5UTR 100% 4.950 6.930 N ZBTB17 n/a
3 TRCN0000235728 GTGCACCTGGACATCAGTAAC pLKO_005 362 5UTR 100% 10.800 8.640 N ZBTB17 n/a
4 TRCN0000012956 CGAGTACTTCAAGATGCTCTT pLKO.1 322 5UTR 100% 4.050 3.240 N ZBTB17 n/a
5 TRCN0000244307 GCCAGTTGGCCAATCATATTC pLKO_005 1918 CDS 100% 13.200 9.240 N ZBTB17 n/a
6 TRCN0000235729 GTTCACTTTAAGGCTCATAAA pLKO_005 281 5UTR 100% 13.200 9.240 N ZBTB17 n/a
7 TRCN0000012955 CCTGTCCAAGCACATCATCAT pLKO.1 2006 CDS 100% 4.950 3.465 N ZBTB17 n/a
8 TRCN0000012953 GCGGACTTCTATCAGCAGTAT pLKO.1 2457 CDS 100% 4.950 3.465 N ZBTB17 n/a
9 TRCN0000235727 CGAGAGCTCGGAGCAAGAAAT pLKO_005 851 CDS 100% 13.200 7.920 N ZBTB17 n/a
10 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 2028 CDS 100% 6.000 3.000 Y Zfp612 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.