Transcript: Human XM_011542361.3

PREDICTED: Homo sapiens eukaryotic translation initiation factor 4 gamma 3 (EIF4G3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF4G3 (8672)
Length:
6357
CDS:
594..5516

Additional Resources:

NCBI RefSeq record:
XM_011542361.3
NBCI Gene record:
EIF4G3 (8672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218906 ACTACAAGCATCGATAGTAAA pLKO_005 5297 CDS 100% 13.200 18.480 N EIF4G3 n/a
2 TRCN0000230500 GAGCGGCTGAAAGGAGTTATT pLKO_005 3114 CDS 100% 13.200 18.480 N EIF4G3 n/a
3 TRCN0000139367 CCCTGTAGTGTAGCACCTAAT pLKO.1 1773 CDS 100% 10.800 15.120 N EIF4G3 n/a
4 TRCN0000142702 CGATGTCTAGTAACGCTGAAA pLKO.1 3198 CDS 100% 4.950 6.930 N EIF4G3 n/a
5 TRCN0000230501 CACGTATGGACCAGTACTTTA pLKO_005 3598 CDS 100% 13.200 9.240 N EIF4G3 n/a
6 TRCN0000230499 CTTAGTAGCCAACCAATATTC pLKO_005 1617 CDS 100% 13.200 9.240 N EIF4G3 n/a
7 TRCN0000230502 TAAACAAGGACTCATACTTAA pLKO_005 5785 3UTR 100% 13.200 9.240 N EIF4G3 n/a
8 TRCN0000140202 GATCCAAACCAGGGAGGTAAA pLKO.1 1197 CDS 100% 10.800 7.560 N EIF4G3 n/a
9 TRCN0000139543 CCTCTCAGCTTGCTTCAGAAA pLKO.1 6063 3UTR 100% 4.950 3.465 N EIF4G3 n/a
10 TRCN0000139951 GCCAAAGAAGAGAACCCAGAA pLKO.1 2878 CDS 100% 4.050 2.835 N EIF4G3 n/a
11 TRCN0000141978 GACTGCAAATGCCAGTGTAAT pLKO.1 5858 3UTR 100% 13.200 7.920 N EIF4G3 n/a
12 TRCN0000143786 GCAGTTTCTGTAAACAACTGT pLKO.1 5889 3UTR 100% 0.300 0.210 N EIF4G3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.