Transcript: Human XM_011542466.1

PREDICTED: Homo sapiens syndecan 3 (SDC3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDC3 (9672)
Length:
4963
CDS:
16..1218

Additional Resources:

NCBI RefSeq record:
XM_011542466.1
NBCI Gene record:
SDC3 (9672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422430 CTGCAACCTCTTGCTCGTATC pLKO_005 1677 3UTR 100% 6.000 8.400 N SDC3 n/a
2 TRCN0000118185 CACACTGCTCATCTATCGTAT pLKO.1 1101 CDS 100% 4.950 6.930 N SDC3 n/a
3 TRCN0000118183 GATGACTCCTTTCCCGATGAT pLKO.1 88 CDS 100% 4.950 6.930 N SDC3 n/a
4 TRCN0000434648 GGTAAACACAGCCCTTGAAAT pLKO_005 1646 3UTR 100% 13.200 9.240 N SDC3 n/a
5 TRCN0000118184 CTCATCTATCGTATGAAGAAA pLKO.1 1108 CDS 100% 5.625 3.938 N SDC3 n/a
6 TRCN0000118182 CCAGAAGAAGAGACCACACAA pLKO.1 847 CDS 100% 4.950 3.465 N SDC3 n/a
7 TRCN0000423059 TGTGCCCTTACGAGCTCATCT pLKO_005 1418 3UTR 100% 4.950 3.465 N SDC3 n/a
8 TRCN0000118186 CGCAGTGAGAACTTCGAGAGA pLKO.1 40 CDS 100% 2.640 1.848 N SDC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11400 pDONR223 100% 88.1% 82.9% None (many diffs) n/a
2 ccsbBroad304_11400 pLX_304 0% 88.1% 82.9% V5 (many diffs) n/a
3 TRCN0000467286 GAACAGGAATGCGAATTAAGGCAG pLX_317 35.7% 88.1% 82.9% V5 (many diffs) n/a
Download CSV