Transcript: Human XM_011542828.2

PREDICTED: Homo sapiens von Willebrand factor A domain containing 5A (VWA5A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VWA5A (4013)
Length:
3640
CDS:
273..2681

Additional Resources:

NCBI RefSeq record:
XM_011542828.2
NBCI Gene record:
VWA5A (4013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179413 CGGTTGTGAAAGCTGCTATTA pLKO.1 2617 CDS 100% 13.200 18.480 N VWA5A n/a
2 TRCN0000433158 GCGTGAACATTTACGAGTTTG pLKO_005 388 CDS 100% 10.800 15.120 N VWA5A n/a
3 TRCN0000128376 GAGAAGTTACAGACACGTTTA pLKO.1 1504 CDS 100% 10.800 8.640 N VWA5A n/a
4 TRCN0000435608 AGCTTTCATTGCTATCAATAA pLKO_005 2078 CDS 100% 13.200 9.240 N VWA5A n/a
5 TRCN0000148425 CAGGAGAAGTATGCCTCAAAT pLKO.1 1858 CDS 100% 13.200 9.240 N VWA5A n/a
6 TRCN0000428514 GACGTGGAACTCCTGATTTAC pLKO_005 999 CDS 100% 13.200 9.240 N VWA5A n/a
7 TRCN0000416291 GACATTCCAGATGGACGATTA pLKO_005 2279 CDS 100% 10.800 7.560 N VWA5A n/a
8 TRCN0000130090 CCAAGATCCTAGGTATGAGTT pLKO.1 2422 CDS 100% 4.950 3.465 N VWA5A n/a
9 TRCN0000129058 GCTGCTGAAGAGTTTACCTAT pLKO.1 1265 CDS 100% 4.950 3.465 N VWA5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00947 pDONR223 100% 51.7% 51.7% None 1_48del;1294_2406del n/a
2 ccsbBroad304_00947 pLX_304 0% 51.7% 51.7% V5 1_48del;1294_2406del n/a
3 TRCN0000465538 AATCGGGACTGATGGGCAGCATGG pLX_317 27.7% 51.7% 51.7% V5 1_48del;1294_2406del n/a
Download CSV