Transcript: Human XM_011542873.1

PREDICTED: Homo sapiens contactin 5 (CNTN5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN5 (53942)
Length:
2938
CDS:
505..2448

Additional Resources:

NCBI RefSeq record:
XM_011542873.1
NBCI Gene record:
CNTN5 (53942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418469 AGTAGGGTTGAGATGGTTAAT pLKO_005 1804 CDS 100% 13.200 18.480 N CNTN5 n/a
2 TRCN0000073402 CTGAAATTATAGCTTCGCTAT pLKO.1 2183 CDS 100% 4.050 5.670 N CNTN5 n/a
3 TRCN0000421335 TCATCTATAGCTGGGTATTTA pLKO_005 1181 CDS 100% 15.000 10.500 N CNTN5 n/a
4 TRCN0000073401 CCATGTGTCTTTCAGAGTATT pLKO.1 545 CDS 100% 13.200 9.240 N CNTN5 n/a
5 TRCN0000429099 AGGATAGAACTTACTCCTAAA pLKO_005 2221 CDS 100% 10.800 7.560 N CNTN5 n/a
6 TRCN0000073400 GCTGAAATTATAGCTTCGCTA pLKO.1 2182 CDS 100% 2.640 1.848 N CNTN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12027 pDONR223 100% 38.2% 36.6% None (many diffs) n/a
2 ccsbBroad304_12027 pLX_304 0% 38.2% 36.6% V5 (many diffs) n/a
3 TRCN0000477911 ACCGGAATCGACCATTCGATAGGA pLX_317 18.7% 38.2% 36.6% V5 (many diffs) n/a
Download CSV