Transcript: Human XM_011543130.1

PREDICTED: Homo sapiens membrane associated ring-CH-type finger 3 (MARCHF3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCHF3 (115123)
Length:
3966
CDS:
205..1047

Additional Resources:

NCBI RefSeq record:
XM_011543130.1
NBCI Gene record:
MARCHF3 (115123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073174 CCGCAGTATGTCATGCAAGTT pLKO.1 316 CDS 100% 4.950 6.930 N MARCHF3 n/a
2 TRCN0000437062 CCTTAAGCCTGTGGGTCTAAG pLKO_005 1139 3UTR 100% 10.800 8.640 N MARCHF3 n/a
3 TRCN0000073173 GCAGAACAAGTCATATTTGAA pLKO.1 1600 3UTR 100% 5.625 4.500 N MARCHF3 n/a
4 TRCN0000424804 TGCTACGGATGCAATTCAATT pLKO_005 1347 3UTR 100% 13.200 9.240 N MARCHF3 n/a
5 TRCN0000412774 TCTGTCAATGTACCTTCTAAC pLKO_005 967 CDS 100% 10.800 7.560 N MARCHF3 n/a
6 TRCN0000073177 CAGAGGGTGATTCTCCTCATT pLKO.1 940 CDS 100% 4.950 3.465 N MARCHF3 n/a
7 TRCN0000073175 CTCTTCACTATTTACCTCTTT pLKO.1 859 CDS 100% 4.950 3.465 N MARCHF3 n/a
8 TRCN0000073176 ACTCTTCACTATTTACCTCTT pLKO.1 858 CDS 100% 4.050 2.835 N MARCHF3 n/a
9 TRCN0000432606 CTCAAAGGAGACAGTTGTTTG pLKO_005 1026 CDS 100% 10.800 6.480 N MARCHF3 n/a
10 TRCN0000249112 CACTGGCTGTCATCCTCAAAT pLKO_005 511 CDS 100% 13.200 9.240 N March3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.