Transcript: Human XM_011543146.2

PREDICTED: Homo sapiens embigin (EMB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EMB (133418)
Length:
4096
CDS:
182..1015

Additional Resources:

NCBI RefSeq record:
XM_011543146.2
NBCI Gene record:
EMB (133418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151468 CCTTTGCCATTTGTCTTAGAA pLKO.1 1377 3UTR 100% 5.625 3.375 N EMB n/a
2 TRCN0000154419 GCAACAGGAAGCACCTTGTAT pLKO.1 383 CDS 100% 5.625 3.375 N EMB n/a
3 TRCN0000152301 CACTGACTGAACATTCTAGTA pLKO.1 219 CDS 100% 4.950 2.970 N EMB n/a
4 TRCN0000155775 CCTGTTAAGAGCCTCTGAGTT pLKO.1 1084 3UTR 100% 4.950 2.970 N EMB n/a
5 TRCN0000150700 GCTTTGTTTATCCTTCCTGTT pLKO.1 1069 3UTR 100% 4.050 2.430 N EMB n/a
6 TRCN0000150725 CCTGTTGGTGTTCAAATGAAT pLKO.1 635 CDS 100% 5.625 2.813 Y EMB n/a
7 TRCN0000151423 GCAGTAAATGTGACTTGGAAA pLKO.1 323 CDS 100% 4.950 2.475 Y EMB n/a
8 TRCN0000151147 GAACATTCTAGTATGCCAGTA pLKO.1 227 CDS 100% 4.050 2.025 Y EMB n/a
9 TRCN0000151682 GCTGAAATCAGATGATAGCAA pLKO.1 940 CDS 100% 3.000 1.500 Y EMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04883 pDONR223 100% 84.7% 84.7% None 0_1ins150 n/a
2 ccsbBroad304_04883 pLX_304 0% 84.7% 84.7% V5 0_1ins150 n/a
3 TRCN0000470101 GAGCACTGATTAGAACTTCAGTGG pLX_317 49.7% 84.7% 84.7% V5 0_1ins150 n/a
Download CSV