Transcript: Human XM_011543178.1

PREDICTED: Homo sapiens solute carrier family 38 member 9 (SLC38A9), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A9 (153129)
Length:
2599
CDS:
436..1950

Additional Resources:

NCBI RefSeq record:
XM_011543178.1
NBCI Gene record:
SLC38A9 (153129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422821 ATAGGAGGGATCATAAGATAT pLKO_005 1768 CDS 100% 13.200 18.480 N SLC38A9 n/a
2 TRCN0000150636 GCTTATATGCTGGTGACATTA pLKO.1 1450 CDS 100% 13.200 18.480 N SLC38A9 n/a
3 TRCN0000154040 CCATCGGATCTAAGATCCAAA pLKO.1 526 CDS 100% 4.950 6.930 N SLC38A9 n/a
4 TRCN0000101974 CGGTGACATTTATCCTAGCAT pLKO.1 1677 CDS 100% 3.000 4.200 N Slc38a9 n/a
5 TRCN0000151238 GCCTTGACAACAGTTCTATAT pLKO.1 1994 3UTR 100% 13.200 9.240 N SLC38A9 n/a
6 TRCN0000431987 GGGTGTCAGAGCAGCATATTG pLKO_005 2295 3UTR 100% 13.200 9.240 N SLC38A9 n/a
7 TRCN0000429700 TTTGTACCAGAGATAAGATTT pLKO_005 1315 CDS 100% 13.200 9.240 N SLC38A9 n/a
8 TRCN0000152456 CCTGACAACAGCTCTATGATT pLKO.1 1054 CDS 100% 5.625 3.938 N SLC38A9 n/a
9 TRCN0000150620 GCTAACCTGATTGTTCAGTTT pLKO.1 1921 CDS 100% 4.950 3.465 N SLC38A9 n/a
10 TRCN0000153429 GCATTGCTTATATGCTGGTGA pLKO.1 1445 CDS 100% 2.640 1.848 N SLC38A9 n/a
11 TRCN0000156474 CCTCTACTGTTTGGGACAGTA pLKO.1 2398 3UTR 100% 0.495 0.347 N SLC38A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09693 pDONR223 100% 89.8% 89.6% None 526_527ins171 n/a
2 ccsbBroad304_09693 pLX_304 0% 89.8% 89.6% V5 526_527ins171 n/a
Download CSV