Transcript: Human XM_011543196.1

PREDICTED: Homo sapiens solute carrier family 25 member 48 (SLC25A48), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A48 (153328)
Length:
1140
CDS:
171..998

Additional Resources:

NCBI RefSeq record:
XM_011543196.1
NBCI Gene record:
SLC25A48 (153328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166137 CAGATGCAGACACAACCGTTT pLKO.1 564 CDS 100% 4.050 5.670 N SLC25A48 n/a
2 TRCN0000164906 GTCTACAACTCCGTGGTGTTT pLKO.1 381 CDS 100% 4.950 3.960 N SLC25A48 n/a
3 TRCN0000164878 GAGAGTATGTTCGGCTTCTTC pLKO.1 327 CDS 100% 4.950 3.465 N SLC25A48 n/a
4 TRCN0000161226 GAGTATGTTCGGCTTCTTCAA pLKO.1 329 CDS 100% 4.950 3.465 N SLC25A48 n/a
5 TRCN0000165403 CATCAAGATCCGGTTGCAGAT pLKO.1 548 CDS 100% 4.050 2.835 N SLC25A48 n/a
6 TRCN0000165730 CTTCTTCAAGGGCATGTCCTT pLKO.1 341 CDS 100% 2.640 1.584 N SLC25A48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09695 pDONR223 100% 54.5% 52.7% None (many diffs) n/a
2 ccsbBroad304_09695 pLX_304 0% 54.5% 52.7% V5 (many diffs) n/a
3 TRCN0000465292 CTTGTGTCCGAAAAACGAACGGCA pLX_317 45.4% 54.5% 52.7% V5 (many diffs) n/a
Download CSV