Transcript: Human XM_011543253.2

PREDICTED: Homo sapiens spermatogenesis associated 24 (SPATA24), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA24 (202051)
Length:
2181
CDS:
124..1245

Additional Resources:

NCBI RefSeq record:
XM_011543253.2
NBCI Gene record:
SPATA24 (202051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543253.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268619 ATCAACTGCGGGACGTGATTG pLKO_005 31 5UTR 100% 10.800 15.120 N SPATA24 n/a
2 TRCN0000268618 AGATTGAGTCTCACATTATAA pLKO_005 392 CDS 100% 15.000 10.500 N SPATA24 n/a
3 TRCN0000268621 ATGGCAAAGAGAATGAGATTA pLKO_005 431 CDS 100% 13.200 9.240 N SPATA24 n/a
4 TRCN0000201737 GCAGCTGGAGAAAGAGAAGAT pLKO.1 285 CDS 100% 4.950 2.970 N Spata24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543253.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13392 pDONR223 100% 30.6% 25.1% None (many diffs) n/a
2 ccsbBroad304_13392 pLX_304 0% 30.6% 25.1% V5 (many diffs) n/a
3 TRCN0000472244 CTTCAACATATCCTGTAATCCCTT pLX_317 84.5% 30.6% 25.1% V5 (many diffs) n/a
Download CSV