Transcript: Human XM_011543286.3

PREDICTED: Homo sapiens follistatin like 4 (FSTL4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FSTL4 (23105)
Length:
6475
CDS:
102..2207

Additional Resources:

NCBI RefSeq record:
XM_011543286.3
NBCI Gene record:
FSTL4 (23105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055619 CCTCCGATTTGACGATTACAA pLKO.1 341 CDS 100% 5.625 7.875 N FSTL4 n/a
2 TRCN0000055618 CCTGCAAATAAACTCGGGCAT pLKO.1 1859 CDS 100% 2.160 3.024 N FSTL4 n/a
3 TRCN0000055621 CCTTCACTGAAAGCAATCAAT pLKO.1 1903 CDS 100% 5.625 3.938 N FSTL4 n/a
4 TRCN0000055620 CGTGGATGTCTCAACTCAGAT pLKO.1 812 CDS 100% 4.950 3.465 N FSTL4 n/a
5 TRCN0000055622 GCCCGCTTGAAGAATGTCCTT pLKO.1 114 CDS 100% 2.640 1.848 N FSTL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11677 pDONR223 100% 54.9% 54.6% None (many diffs) n/a
2 ccsbBroad304_11677 pLX_304 0% 54.9% 54.6% V5 (many diffs) n/a
3 TRCN0000479880 ACATTTGGACCATGCGTCAATGCC pLX_317 19.2% 54.9% 54.6% V5 (many diffs) n/a
Download CSV