Transcript: Human XM_011543522.3

PREDICTED: Homo sapiens zinc finger protein 608 (ZNF608), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF608 (57507)
Length:
5061
CDS:
433..4080

Additional Resources:

NCBI RefSeq record:
XM_011543522.3
NBCI Gene record:
ZNF608 (57507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249821 AGGGCCATCAGTGCCTAATAA pLKO_005 3048 CDS 100% 15.000 21.000 N Zfp608 n/a
2 TRCN0000135061 CCTTGCATATCCTTCACATAT pLKO.1 4516 3UTR 100% 13.200 9.240 N ZNF608 n/a
3 TRCN0000136587 CCTTCCAGTAATCTCCAACAT pLKO.1 1557 CDS 100% 4.950 3.465 N ZNF608 n/a
4 TRCN0000136859 CAGTGTGAATTTGGAAGGGAT pLKO.1 660 CDS 100% 2.640 1.584 N ZNF608 n/a
5 TRCN0000138301 CTGAGGACAATAAGCCTGGAA pLKO.1 1082 CDS 100% 2.640 1.584 N ZNF608 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08737 pDONR223 100% 79.9% 79.8% None (many diffs) n/a
2 ccsbBroad304_08737 pLX_304 11.1% 79.9% 79.8% V5 (many diffs) n/a
3 TRCN0000475830 CTGAAGCCCATCTGTCTATTACCT pLX_317 9.1% 79.9% 79.8% V5 (many diffs) n/a
Download CSV