Transcript: Human XM_011543535.2

PREDICTED: Homo sapiens centromere protein K (CENPK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPK (64105)
Length:
1793
CDS:
269..1084

Additional Resources:

NCBI RefSeq record:
XM_011543535.2
NBCI Gene record:
CENPK (64105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167208 CCGAATAAGATTAGAAGCTTT pLKO.1 1054 CDS 100% 4.950 6.930 N CENPK n/a
2 TRCN0000167369 GAAGACGTTCTCATAACATTA pLKO.1 530 CDS 100% 13.200 10.560 N CENPK n/a
3 TRCN0000417826 ATATCTGAGGTGGCATAATTT pLKO_005 1522 3UTR 100% 15.000 10.500 N CENPK n/a
4 TRCN0000425338 TAAGAATGCAGGTAGATAATA pLKO_005 1296 3UTR 100% 15.000 10.500 N CENPK n/a
5 TRCN0000414848 GAAACACTCACCGATTCAAAT pLKO_005 416 CDS 100% 13.200 9.240 N CENPK n/a
6 TRCN0000167711 GCTGCCATCTATTATTCATTT pLKO.1 1222 3UTR 100% 13.200 9.240 N CENPK n/a
7 TRCN0000420914 GATGTTCCACATGATCCATAT pLKO_005 947 CDS 100% 10.800 7.560 N CENPK n/a
8 TRCN0000438194 TGAGTACCTTGGGCGAGTTTC pLKO_005 804 CDS 100% 10.800 7.560 N CENPK n/a
9 TRCN0000167368 GAAATGTGGAAAGATATGGAA pLKO.1 362 CDS 100% 3.000 2.100 N CENPK n/a
10 TRCN0000167551 GTACCTTACCTCATGCAATAT pLKO.1 1339 3UTR 100% 0.000 0.000 N CENPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03924 pDONR223 100% 99% 98.5% None 5_12delCCCTCTTCinsAT n/a
2 ccsbBroad304_03924 pLX_304 0% 99% 98.5% V5 5_12delCCCTCTTCinsAT n/a
3 TRCN0000467235 TTGATGGAGCACTCTTGGTGCAAC pLX_317 29.7% 99% 98.5% V5 5_12delCCCTCTTCinsAT n/a
Download CSV