Transcript: Human XM_011543646.1

PREDICTED: Homo sapiens ankyrin repeat domain 55 (ANKRD55), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD55 (79722)
Length:
1814
CDS:
148..1311

Additional Resources:

NCBI RefSeq record:
XM_011543646.1
NBCI Gene record:
ANKRD55 (79722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245549 CAGCGGGCTTCAGCGATATTA pLKO_005 190 CDS 100% 15.000 21.000 N ANKRD55 n/a
2 TRCN0000245545 TAAGAACGAAGACCAATTTAG pLKO_005 1387 3UTR 100% 13.200 10.560 N ANKRD55 n/a
3 TRCN0000245547 AGTGATTCTAATCAGGTATTT pLKO_005 952 CDS 100% 13.200 9.240 N ANKRD55 n/a
4 TRCN0000147256 GCATTCTATAAGCCATCAGTT pLKO.1 1414 3UTR 100% 4.950 3.465 N ANKRD55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12601 pDONR223 100% 83.4% 75.6% None 1_188del;286_287insCAGAA n/a
2 ccsbBroad304_12601 pLX_304 0% 83.4% 75.6% V5 1_188del;286_287insCAGAA n/a
3 TRCN0000475370 AGCGCCTCCCGATCACTGAGCCCT pLX_317 34.6% 83.4% 75.6% V5 1_188del;286_287insCAGAA n/a
Download CSV