Transcript: Human XM_011543709.2

PREDICTED: Homo sapiens CDKN2A interacting protein N-terminal like (CDKN2AIPNL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKN2AIPNL (91368)
Length:
1509
CDS:
133..462

Additional Resources:

NCBI RefSeq record:
XM_011543709.2
NBCI Gene record:
CDKN2AIPNL (91368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16062 pDONR223 0% 74.1% 72.9% None (many diffs) n/a
2 ccsbBroad304_16062 pLX_304 0% 74.1% 72.9% V5 (many diffs) n/a
3 TRCN0000466020 ACTGTCAGATTCACTGTCAACTTC pLX_317 100% 74.1% 72.9% V5 (many diffs) n/a
4 ccsbBroadEn_04540 pDONR223 100% 61.1% 57.9% None (many diffs) n/a
5 ccsbBroad304_04540 pLX_304 0% 61.1% 57.9% V5 (many diffs) n/a
6 TRCN0000468948 GAACAATTCTCCAATCTTCAAACA pLX_317 100% 61.1% 57.9% V5 (many diffs) n/a
Download CSV