Transcript: Human XM_011544017.1

PREDICTED: Homo sapiens calpain 9 (CAPN9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPN9 (10753)
Length:
2284
CDS:
98..2263

Additional Resources:

NCBI RefSeq record:
XM_011544017.1
NBCI Gene record:
CAPN9 (10753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430600 GGACGCCGTTTGGTCTTATTA pLKO_005 831 CDS 100% 15.000 21.000 N CAPN9 n/a
2 TRCN0000051212 GCCTACAGTGTAACGGGAATT pLKO.1 860 CDS 100% 0.000 0.000 N CAPN9 n/a
3 TRCN0000424995 ACAATCGGCTATGCCATTTAT pLKO_005 1346 CDS 100% 15.000 10.500 N CAPN9 n/a
4 TRCN0000051208 CCCGAGAACTTCTATGAGATT pLKO.1 734 CDS 100% 4.950 3.465 N CAPN9 n/a
5 TRCN0000051211 CCTTCGGTTTGATGCTGACAA pLKO.1 1897 CDS 100% 4.950 3.465 N CAPN9 n/a
6 TRCN0000051209 GCCAAGCTAAATGGGAGCTAT pLKO.1 629 CDS 100% 4.950 3.465 N CAPN9 n/a
7 TRCN0000051210 CCACTTTGATAAAGTGGAGAT pLKO.1 1075 CDS 100% 0.405 0.284 N CAPN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11545 pDONR223 100% 81.9% 82% None (many diffs) n/a
2 ccsbBroad304_11545 pLX_304 0% 81.9% 82% V5 (many diffs) n/a
3 TRCN0000479280 AAACCTGTAGTTTTCCCTACCCAA pLX_317 19.3% 81.9% 82% V5 (many diffs) n/a
Download CSV