Transcript: Human XM_011544490.3

PREDICTED: Homo sapiens ankyrin 1 (ANK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANK1 (286)
Length:
8492
CDS:
81..5990

Additional Resources:

NCBI RefSeq record:
XM_011544490.3
NBCI Gene record:
ANK1 (286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434160 ACACGGAAGTGGCCAAATATT pLKO_005 1621 CDS 100% 15.000 21.000 N ANK1 n/a
2 TRCN0000083721 CGTCACGGATGAAACCAGTTT pLKO.1 2639 CDS 100% 4.950 6.930 N ANK1 n/a
3 TRCN0000083720 GCTTGTCAACTATGGAGCCAA pLKO.1 563 CDS 100% 2.640 2.112 N ANK1 n/a
4 TRCN0000432560 CACAAATGGCCTTATCGATTT pLKO_005 5189 CDS 100% 10.800 7.560 N ANK1 n/a
5 TRCN0000083718 GCCAATTTCAATACGAATCAT pLKO.1 6691 3UTR 100% 5.625 3.938 N ANK1 n/a
6 TRCN0000083719 CGTCAATTTCACACCACAGAA pLKO.1 968 CDS 100% 4.950 3.465 N ANK1 n/a
7 TRCN0000083722 GTTTCGTGTTAGTCAGTGATA pLKO.1 2656 CDS 100% 4.950 3.465 N ANK1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6565 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10678 pDONR223 100% 5.6% 3.8% None (many diffs) n/a
2 ccsbBroad304_10678 pLX_304 0% 5.6% 3.8% V5 (many diffs) n/a
3 TRCN0000472544 GTTGCCTAACTCTATTAAATGTCT pLX_317 100% 5.6% 3.8% V5 (many diffs) n/a
Download CSV