Transcript: Human XM_011544597.3

PREDICTED: Homo sapiens tRNA methyltransferase 9B (putative) (TRMT9B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT9B (57604)
Length:
9476
CDS:
124..1743

Additional Resources:

NCBI RefSeq record:
XM_011544597.3
NBCI Gene record:
TRMT9B (57604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140695 GCTATGAACCTGCTATGGCAA pLKO.1 1025 CDS 100% 2.640 3.696 N TRMT9B n/a
2 TRCN0000143010 CCAGGCACTCTGAAACATTTA pLKO.1 1357 CDS 100% 13.200 9.240 N TRMT9B n/a
3 TRCN0000144063 CCATAGGAGTCATACATCATT pLKO.1 698 CDS 100% 5.625 3.938 N TRMT9B n/a
4 TRCN0000143219 GCACAGATTCTGGCATTGAAA pLKO.1 1907 3UTR 100% 5.625 3.938 N TRMT9B n/a
5 TRCN0000143814 GCCAGTAATTCCTCTGTCTTT pLKO.1 5553 3UTR 100% 4.950 3.465 N TRMT9B n/a
6 TRCN0000144663 GCCTTTCTATTTCCTTCCAAA pLKO.1 5524 3UTR 100% 4.950 2.970 N TRMT9B n/a
7 TRCN0000245346 GGGCTTGTATATAGATTATAA pLKO_005 6115 3UTR 100% 15.000 7.500 Y Prrc2a n/a
8 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 8394 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 5023 3UTR 100% 13.200 6.600 Y IQCC n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2429 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5120 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12375 pDONR223 100% 67.5% 67.3% None (many diffs) n/a
2 ccsbBroad304_12375 pLX_304 0% 67.5% 67.3% V5 (many diffs) n/a
3 TRCN0000465888 CATAGAGTTGCCTGGTATGAGCGT pLX_317 31.8% 67.5% 67.3% V5 (many diffs) n/a
Download CSV