Transcript: Human XM_011544676.3

PREDICTED: Homo sapiens fucosyltransferase 10 (FUT10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FUT10 (84750)
Length:
2848
CDS:
324..2138

Additional Resources:

NCBI RefSeq record:
XM_011544676.3
NBCI Gene record:
FUT10 (84750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419613 GACAATTACATCGATGCATTT pLKO_005 1590 CDS 100% 10.800 15.120 N FUT10 n/a
2 TRCN0000035373 GCCACTAACTACCCAATACTT pLKO.1 986 CDS 100% 5.625 7.875 N FUT10 n/a
3 TRCN0000035371 GCACAGTATAAGTTTATCCTA pLKO.1 1263 CDS 100% 3.000 4.200 N FUT10 n/a
4 TRCN0000442785 GTCCTGAAGTCACTCCGATAC pLKO_005 1020 CDS 100% 6.000 4.800 N FUT10 n/a
5 TRCN0000415881 TGGTGAATGTTTACGAAACAA pLKO_005 1178 CDS 100% 5.625 4.500 N FUT10 n/a
6 TRCN0000423924 CACCAAGGTGTGGGCTAATAT pLKO_005 1625 CDS 100% 15.000 10.500 N FUT10 n/a
7 TRCN0000035372 CCTACGCATCTTAATTCATTT pLKO.1 615 CDS 100% 13.200 9.240 N FUT10 n/a
8 TRCN0000435385 ATGGTACTGACTTTAACATAG pLKO_005 823 CDS 100% 10.800 7.560 N FUT10 n/a
9 TRCN0000427316 TGTGGAGCAGATGCTTGTTTC pLKO_005 747 CDS 100% 10.800 7.560 N FUT10 n/a
10 TRCN0000417809 AGATTGTATGAGGCCTATGTA pLKO_005 1482 CDS 100% 5.625 3.938 N FUT10 n/a
11 TRCN0000035370 GCTCTTTCATAAACCAGTGAT pLKO.1 920 CDS 100% 4.950 3.465 N FUT10 n/a
12 TRCN0000427634 TTTGAGCTCTTTGCGAGAGAT pLKO_005 1754 CDS 100% 4.950 3.465 N FUT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492215 TGCTACTGTCTCCCGTGGCGCAAT pLX_317 100% 22.7% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV