Transcript: Human XM_011544758.1

PREDICTED: Homo sapiens X-ray radiation resistance associated 1 (XRRA1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XRRA1 (143570)
Length:
4835
CDS:
333..2564

Additional Resources:

NCBI RefSeq record:
XM_011544758.1
NBCI Gene record:
XRRA1 (143570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246335 GCGACTGGGAATCCACTTAAT pLKO_005 1460 CDS 100% 13.200 18.480 N XRRA1 n/a
2 TRCN0000246334 CAGATGAGCAACTGGATTATA pLKO_005 1108 CDS 100% 15.000 12.000 N XRRA1 n/a
3 TRCN0000257496 TCAGATCTGTGCACCATTAAT pLKO_005 639 CDS 100% 15.000 10.500 N XRRA1 n/a
4 TRCN0000257505 AGACAAGACTCTGACTATAAA pLKO_005 3323 3UTR 100% 15.000 9.000 N XRRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13216 pDONR223 100% 69% 65.8% None (many diffs) n/a
2 ccsbBroad304_13216 pLX_304 0% 69% 65.8% V5 (many diffs) n/a
3 TRCN0000468202 AGATGAGCGTCCCATCGAAGAGAA pLX_317 18.9% 69% 65.8% V5 (many diffs) n/a
Download CSV