Transcript: Human XM_011544881.3

PREDICTED: Homo sapiens DNA polymerase alpha 2, accessory subunit (POLA2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLA2 (23649)
Length:
1975
CDS:
377..1939

Additional Resources:

NCBI RefSeq record:
XM_011544881.3
NBCI Gene record:
POLA2 (23649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322914 GGAATGGTAGGCGAGCTTATA pLKO_005 494 CDS 100% 13.200 18.480 N POLA2 n/a
2 TRCN0000053074 CCTCTCCATAAACGGAGTGAT pLKO.1 1759 CDS 100% 4.950 6.930 N POLA2 n/a
3 TRCN0000053077 CCGAGGAGATCAGTAGTTCTT pLKO.1 1821 CDS 100% 4.950 3.960 N POLA2 n/a
4 TRCN0000322846 CACTAACTGGGAGCTACAAAT pLKO_005 978 CDS 100% 13.200 9.240 N POLA2 n/a
5 TRCN0000350651 GACTGCGAGGAGGCTCTAATT pLKO_005 428 CDS 100% 13.200 9.240 N POLA2 n/a
6 TRCN0000053073 GCACACATAAAGTTGGCCTTA pLKO.1 528 CDS 100% 4.050 2.835 N POLA2 n/a
7 TRCN0000053075 CCAGTGGATTTATCTGAGCTT pLKO.1 1229 CDS 100% 2.640 1.848 N POLA2 n/a
8 TRCN0000053076 CCCAGAAATACAACTCACGAA pLKO.1 849 CDS 100% 2.640 1.848 N POLA2 n/a
9 TRCN0000375269 CCCTGCAGCCTCTCCATAAAT pLKO_005 1751 CDS 100% 15.000 10.500 N Pola2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02825 pDONR223 100% 86.9% 85.1% None 1518_1519ins70;1560_1561ins164 n/a
2 ccsbBroad304_02825 pLX_304 0% 86.9% 85.1% V5 1518_1519ins70;1560_1561ins164 n/a
3 TRCN0000473969 GGTACCGATAACTACTACATTCAC pLX_317 24% 86.9% 85.1% V5 1518_1519ins70;1560_1561ins164 n/a
Download CSV