Transcript: Human XM_011545227.3

PREDICTED: Homo sapiens UV radiation resistance associated (UVRAG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UVRAG (7405)
Length:
6316
CDS:
220..1677

Additional Resources:

NCBI RefSeq record:
XM_011545227.3
NBCI Gene record:
UVRAG (7405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377200 CACGTGGCGAAGTCTCGATTT pLKO_005 495 CDS 100% 10.800 15.120 N UVRAG n/a
2 TRCN0000376394 TGCGGTGTCAAGTTGCCTAAT pLKO_005 1243 CDS 100% 10.800 8.640 N UVRAG n/a
3 TRCN0000364401 AGCTCCTTGATACCTACTTTA pLKO_005 398 CDS 100% 13.200 9.240 N UVRAG n/a
4 TRCN0000368923 CATTTGAACATAAGGGTTATT pLKO_005 713 CDS 100% 13.200 9.240 N UVRAG n/a
5 TRCN0000364333 TTCGACATCTTCGGAACATTG pLKO_005 344 CDS 100% 10.800 7.560 N UVRAG n/a
6 TRCN0000005199 CCCGGAACATTGTTAATAGAA pLKO.1 368 CDS 100% 5.625 3.938 N UVRAG n/a
7 TRCN0000121011 CCTACATTTACCCTATTGATT pLKO.1 1196 CDS 100% 5.625 3.938 N Uvrag n/a
8 TRCN0000005200 GCAGTTTGATTATGGTGTCTA pLKO.1 1479 CDS 100% 4.950 3.465 N UVRAG n/a
9 TRCN0000005201 GCCCTTGGTTATACTGCACAT pLKO.1 1306 CDS 100% 4.050 2.835 N UVRAG n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3087 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3048 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3048 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3048 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000136945 CCATGATTCAATTACCTCCCA pLKO.1 4153 3UTR 100% 0.660 0.330 Y DISC1 n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3084 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.