Transcript: Human XM_011545291.2

PREDICTED: Homo sapiens unc-93 homolog B1, TLR signaling regulator (UNC93B1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC93B1 (81622)
Length:
2214
CDS:
530..1768

Additional Resources:

NCBI RefSeq record:
XM_011545291.2
NBCI Gene record:
UNC93B1 (81622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136779 CTTTCTTTATCTACAGCGGCT pLKO.1 1008 CDS 100% 0.540 0.432 N UNC93B1 n/a
2 TRCN0000138268 CAAGGAGAGACAGGACTTCAT pLKO.1 1363 CDS 100% 4.950 3.465 N UNC93B1 n/a
3 TRCN0000138346 CCTCTTTGTCTCCACCAACTA pLKO.1 345 5UTR 100% 4.950 3.465 N UNC93B1 n/a
4 TRCN0000137362 GCTGCCCATGATTTATTTCCT pLKO.1 682 CDS 100% 3.000 2.100 N UNC93B1 n/a
5 TRCN0000138225 CAGCTTCTTCCATCTGAGCTT pLKO.1 649 CDS 100% 2.640 1.848 N UNC93B1 n/a
6 TRCN0000138506 CCAAGCCATCTTCTACAGCTT pLKO.1 634 CDS 100% 2.640 1.584 N UNC93B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04248 pDONR223 100% 69% 69% None 0_1ins555 n/a
2 ccsbBroad304_04248 pLX_304 0% 69% 69% V5 0_1ins555 n/a
3 TRCN0000477552 CAAGAGCGCCTAAAGGCCGCTAAC pLX_317 17.1% 69% 69% V5 0_1ins555 n/a
Download CSV