Transcript: Human XM_011545303.3

PREDICTED: Homo sapiens synoviolin 1 (SYVN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYVN1 (84447)
Length:
2982
CDS:
943..2796

Additional Resources:

NCBI RefSeq record:
XM_011545303.3
NBCI Gene record:
SYVN1 (84447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364477 AGCTCCAGGCAATGGACAATG pLKO_005 1790 CDS 100% 10.800 7.560 N SYVN1 n/a
2 TRCN0000364420 GCAACATGAACACCCTGTATC pLKO_005 1751 CDS 100% 10.800 7.560 N SYVN1 n/a
3 TRCN0000364476 TCACCATCTTCATCAAGTATG pLKO_005 1499 CDS 100% 10.800 7.560 N SYVN1 n/a
4 TRCN0000376399 TGATGGGCAAGGTGTTCTTTG pLKO_005 1121 CDS 100% 10.800 7.560 N SYVN1 n/a
5 TRCN0000034006 GCTCACGCCTACTACCTCAAA pLKO.1 1000 CDS 100% 4.950 3.465 N SYVN1 n/a
6 TRCN0000034007 GACCGTGTGGACTTTATGGAA pLKO.1 1306 CDS 100% 3.000 2.100 N SYVN1 n/a
7 TRCN0000369081 CCAACATCTCCTGGCTCTTTC pLKO_005 1334 CDS 100% 10.800 6.480 N SYVN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09190 pDONR223 100% 99.9% 99.8% None 982A>C n/a
2 ccsbBroad304_09190 pLX_304 0% 99.9% 99.8% V5 982A>C n/a
3 TRCN0000491715 CAGCACTTGATGATGCGATCCTGC pLX_317 20.3% 99.9% 99.8% V5 982A>C n/a
Download CSV