Transcript: Human XM_011545393.3

PREDICTED: Homo sapiens leupaxin (LPXN), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPXN (9404)
Length:
2070
CDS:
173..937

Additional Resources:

NCBI RefSeq record:
XM_011545393.3
NBCI Gene record:
LPXN (9404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073360 CCAACGACTACCACCAACTTT pLKO.1 786 CDS 100% 5.625 4.500 N LPXN n/a
2 TRCN0000073361 ACTTCGGAGATCCTTTCTATT pLKO.1 314 CDS 100% 13.200 9.240 N LPXN n/a
3 TRCN0000073362 CCTTCAGGACAGTGATGAATA pLKO.1 232 CDS 100% 13.200 9.240 N LPXN n/a
4 TRCN0000073359 GCTCGTGTATACTACCAATAT pLKO.1 364 CDS 100% 13.200 9.240 N LPXN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07411 pDONR223 100% 63% 62.4% None (many diffs) n/a
2 ccsbBroad304_07411 pLX_304 0% 63% 62.4% V5 (many diffs) n/a
3 TRCN0000473851 TCTAAACCCTGGGAGAGAGATTCA pLX_317 43.5% 63% 62.4% V5 (many diffs) n/a
Download CSV