Transcript: Human XM_011545533.1

PREDICTED: Homo sapiens phosphate regulating endopeptidase homolog X-linked (PHEX), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHEX (5251)
Length:
4975
CDS:
128..1621

Additional Resources:

NCBI RefSeq record:
XM_011545533.1
NBCI Gene record:
PHEX (5251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434927 TAACCAGTATAGCAACTATTA pLKO_005 1228 CDS 100% 13.200 18.480 N PHEX n/a
2 TRCN0000419798 GTCAATGGTGCAATTAGTAAC pLKO_005 1520 CDS 100% 10.800 15.120 N PHEX n/a
3 TRCN0000047091 CGTCCTACAAACTCGCAAGTA pLKO.1 886 CDS 100% 4.950 6.930 N PHEX n/a
4 TRCN0000047090 GCTGAGATAATGATTCCACAT pLKO.1 215 CDS 100% 4.050 5.670 N PHEX n/a
5 TRCN0000430149 TCAAAGTTGTAGGGCTTATAA pLKO_005 1780 3UTR 100% 15.000 10.500 N PHEX n/a
6 TRCN0000047089 GCCCGAGAACAAGTCCAAATT pLKO.1 1472 CDS 100% 13.200 9.240 N PHEX n/a
7 TRCN0000047092 CCAACTATTTGGTGTGGAGAA pLKO.1 459 CDS 100% 4.050 2.835 N PHEX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01188 pDONR223 100% 66.3% 66.3% None 0_1ins756 n/a
2 ccsbBroad304_01188 pLX_304 0% 66.3% 66.3% V5 0_1ins756 n/a
3 TRCN0000477264 GAGACAGACCGACAGGTCTTATAT pLX_317 10.2% 66.3% 66.3% V5 0_1ins756 n/a
Download CSV