Transcript: Human XM_011545588.1

PREDICTED: Homo sapiens patatin like phospholipase domain containing 4 (PNPLA4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA4 (8228)
Length:
3516
CDS:
931..1692

Additional Resources:

NCBI RefSeq record:
XM_011545588.1
NBCI Gene record:
PNPLA4 (8228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303418 AGAGGAATGTAACCAATTTAC pLKO_005 1107 CDS 100% 13.200 18.480 N PNPLA4 n/a
2 TRCN0000078191 GCAGGATATCATGTTGTCCCT pLKO.1 1548 CDS 100% 0.660 0.924 N PNPLA4 n/a
3 TRCN0000078190 GTTCTGCTAACAGCACCAGAA pLKO.1 1081 CDS 100% 0.405 0.567 N PNPLA4 n/a
4 TRCN0000292099 GTTCTGCTAACAGCACCAGAA pLKO_005 1081 CDS 100% 0.405 0.567 N PNPLA4 n/a
5 TRCN0000078188 CCACTTATTCACTAGGTAAAT pLKO.1 3357 3UTR 100% 13.200 9.240 N PNPLA4 n/a
6 TRCN0000292100 CCACTTATTCACTAGGTAAAT pLKO_005 3357 3UTR 100% 13.200 9.240 N PNPLA4 n/a
7 TRCN0000310689 TGACTTCATGGCCCGACTAAG pLKO_005 1185 CDS 100% 10.800 7.560 N PNPLA4 n/a
8 TRCN0000078192 CTGAAGCTAGTGGAATACAAA pLKO.1 1381 CDS 100% 5.625 3.938 N PNPLA4 n/a
9 TRCN0000292153 CTGAAGCTAGTGGAATACAAA pLKO_005 1381 CDS 100% 5.625 3.938 N PNPLA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07210 pDONR223 100% 99.7% 99.2% None 143T>G;401A>G n/a
2 ccsbBroad304_07210 pLX_304 0% 99.7% 99.2% V5 143T>G;401A>G n/a
3 TRCN0000478572 CCGGAAACAGCCCAGACCCCGTGG pLX_317 45.5% 99.7% 99.2% V5 143T>G;401A>G n/a
Download CSV