Transcript: Human XM_011545679.3

PREDICTED: Homo sapiens zinc finger protein 658 (ZNF658), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF658 (26149)
Length:
4207
CDS:
109..3288

Additional Resources:

NCBI RefSeq record:
XM_011545679.3
NBCI Gene record:
ZNF658 (26149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416713 TAAGATGGATTTGGAGGTTAT pLKO_005 3524 3UTR 100% 10.800 6.480 N ZNF658 n/a
2 TRCN0000019433 CCACCGCTGTTGAATACAATA pLKO.1 953 CDS 100% 13.200 6.600 Y ZNF658 n/a
3 TRCN0000146400 CCCTTAGAGCACATCAGAATA pLKO.1 2291 CDS 100% 13.200 6.600 Y ZNF658B n/a
4 TRCN0000420804 TAGTTAAATGGACGTAGTTTA pLKO_005 3718 3UTR 100% 13.200 6.600 Y ZNF658 n/a
5 TRCN0000019432 CCCTCAGAGTACATCAAAGAA pLKO.1 2963 CDS 100% 5.625 2.813 Y ZNF658 n/a
6 TRCN0000146464 CCCTCATAGTGCATCAAAGAA pLKO.1 2543 CDS 100% 5.625 2.813 Y ZNF658B n/a
7 TRCN0000147868 GTGAGATGAAACCCTATGAAT pLKO.1 3758 3UTR 100% 5.625 2.813 Y ZNF658B n/a
8 TRCN0000019431 GCAGTGAATATGGGAAGACAT pLKO.1 1595 CDS 100% 4.950 2.475 Y ZNF658 n/a
9 TRCN0000019430 GCCCATAATTCAGCCCTCAAA pLKO.1 2194 CDS 100% 4.950 2.475 Y ZNF658 n/a
10 TRCN0000019429 GCCCATATAGTACATCAGAAA pLKO.1 1123 CDS 100% 4.950 2.475 Y ZNF658 n/a
11 TRCN0000147367 GAATGTGATGAATGTGGGAAA pLKO.1 3175 CDS 100% 4.050 2.025 Y ZNF658B n/a
12 TRCN0000148104 GAGTGTAATGAATGTGGGAAA pLKO.1 2671 CDS 100% 4.050 2.025 Y ZNF658B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11817 pDONR223 100% 56.9% 56.2% None (many diffs) n/a
2 ccsbBroad304_11817 pLX_304 0% 56.9% 56.2% V5 (many diffs) n/a
3 TRCN0000474751 CGCTCATGGTCAGTGCTAGTTTGA pLX_317 23.3% 56.9% 56.2% V5 (many diffs) n/a
Download CSV