Transcript: Human XM_011545748.2

PREDICTED: Homo sapiens otoancorin (OTOA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTOA (146183)
Length:
3544
CDS:
506..2902

Additional Resources:

NCBI RefSeq record:
XM_011545748.2
NBCI Gene record:
OTOA (146183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430709 ATCATCTTGTCTGCCAAATAC pLKO_005 659 CDS 100% 13.200 9.240 N OTOA n/a
2 TRCN0000118992 GCGTGGAAATACTGGGAAGTT pLKO.1 1193 CDS 100% 4.950 3.465 N OTOA n/a
3 TRCN0000118994 GCTCTGTTCCTGTATGAGCTT pLKO.1 1004 CDS 100% 2.640 1.848 N OTOA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09625 pDONR223 100% 64.8% 64.7% None 0_1ins1131;1943A>C;2287_2394del n/a
2 ccsbBroad304_09625 pLX_304 0% 64.8% 64.7% V5 0_1ins1131;1943A>C;2287_2394del n/a
3 TRCN0000465295 CAGCAGTATATACTTAGGCTTGGT pLX_317 5% 64.8% 64.7% V5 0_1ins1131;1943A>C;2287_2394del n/a
Download CSV