Transcript: Human XM_011545965.2

PREDICTED: Homo sapiens RNA exonuclease 5 (REXO5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REXO5 (81691)
Length:
2554
CDS:
226..2352

Additional Resources:

NCBI RefSeq record:
XM_011545965.2
NBCI Gene record:
REXO5 (81691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049736 GCTCGGTATTTCCTTAAGCAT pLKO.1 1351 CDS 100% 3.000 4.200 N REXO5 n/a
2 TRCN0000290755 GCTCGGTATTTCCTTAAGCAT pLKO_005 1351 CDS 100% 3.000 4.200 N REXO5 n/a
3 TRCN0000310312 AGGCCAAGAAAGCCCGCTTAT pLKO_005 356 CDS 100% 10.800 7.560 N REXO5 n/a
4 TRCN0000049734 GCCTTCTGACAAAGGAGGAAA pLKO.1 794 CDS 100% 4.950 3.465 N REXO5 n/a
5 TRCN0000290753 GCCTTCTGACAAAGGAGGAAA pLKO_005 794 CDS 100% 4.950 3.465 N REXO5 n/a
6 TRCN0000049737 GCTGTGTGAATTGCTGAAGTA pLKO.1 420 CDS 100% 4.950 3.465 N REXO5 n/a
7 TRCN0000049733 GCCATGTTTCCATGTGCCATT pLKO.1 2361 3UTR 100% 4.050 2.835 N REXO5 n/a
8 TRCN0000049735 GCTGTGATCTTGCCTAAAGAT pLKO.1 1906 CDS 100% 0.563 0.394 N REXO5 n/a
9 TRCN0000290754 GCTGTGATCTTGCCTAAAGAT pLKO_005 1906 CDS 100% 0.563 0.394 N REXO5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09081 pDONR223 100% 91.4% 91.4% None 1382_1383ins105;1519_1520ins93 n/a
2 ccsbBroad304_09081 pLX_304 0% 91.4% 91.4% V5 1382_1383ins105;1519_1520ins93 n/a
3 TRCN0000466974 GCGCCCTTACAGAGCGCGTTGTAT pLX_317 15.1% 91.4% 91.4% V5 1382_1383ins105;1519_1520ins93 n/a
Download CSV