Transcript: Human XM_011546001.3

PREDICTED: Homo sapiens heparan sulfate-glucosamine 3-sulfotransferase 2 (HS3ST2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HS3ST2 (9956)
Length:
2691
CDS:
446..1060

Additional Resources:

NCBI RefSeq record:
XM_011546001.3
NBCI Gene record:
HS3ST2 (9956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011546001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035847 GTGCTGGAGTTTATCCGAGTA pLKO.1 833 CDS 100% 4.050 2.835 N HS3ST2 n/a
2 TRCN0000035846 GCTCTCGCTCTCCTGCACTTA pLKO.1 520 CDS 100% 1.650 1.155 N HS3ST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011546001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02274 pDONR223 100% 51.6% 44.3% None (many diffs) n/a
2 ccsbBroad304_02274 pLX_304 0% 51.6% 44.3% V5 (many diffs) n/a
3 TRCN0000480039 TTGTAAAATTTGTTCCCGAGAGCC pLX_317 35% 51.6% 44.3% V5 (many diffs) n/a
Download CSV