Transcript: Human XM_017000075.2

PREDICTED: Homo sapiens semaphorin 6C (SEMA6C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA6C (10500)
Length:
4782
CDS:
1466..4354

Additional Resources:

NCBI RefSeq record:
XM_017000075.2
NBCI Gene record:
SEMA6C (10500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005663 CCGAGTATGTAAACGTGACAT pLKO.1 2242 CDS 100% 4.950 6.930 N SEMA6C n/a
2 TRCN0000413116 AGTCCAACGTGGCCATCTTTG pLKO_005 1989 CDS 100% 10.800 8.640 N SEMA6C n/a
3 TRCN0000005664 GCTGTAGTTTACAGAAGCCTT pLKO.1 2060 CDS 100% 2.640 2.112 N SEMA6C n/a
4 TRCN0000418932 ATGAGTGCTACAACTATATTC pLKO_005 1821 CDS 100% 13.200 9.240 N SEMA6C n/a
5 TRCN0000423159 CTTCACCACCCAGACCAATAG pLKO_005 2419 CDS 100% 10.800 7.560 N SEMA6C n/a
6 TRCN0000412722 TCCTCAGTGAGCCAGCATTTC pLKO_005 4567 3UTR 100% 10.800 7.560 N SEMA6C n/a
7 TRCN0000005662 CGCCTCGGGTTTATTTATTGA pLKO.1 4496 3UTR 100% 5.625 3.938 N SEMA6C n/a
8 TRCN0000005666 GTGGAACCAGAACAGGAACAA pLKO.1 3721 CDS 100% 4.950 3.465 N SEMA6C n/a
9 TRCN0000005665 GATGTGGAGAACTGTGCTGTA pLKO.1 1784 CDS 100% 4.050 2.835 N SEMA6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11508 pDONR223 100% 50.4% 45.1% None (many diffs) n/a
2 ccsbBroad304_11508 pLX_304 0% 50.4% 45.1% V5 (many diffs) n/a
3 TRCN0000468488 TGAGGCTCTTGCAGCGGACGCTCC pLX_317 27.4% 50.4% 45.1% V5 (many diffs) n/a
4 ccsbBroadEn_11509 pDONR223 100% 45.2% 42.6% None (many diffs) n/a
5 ccsbBroad304_11509 pLX_304 0% 45.2% 42.6% V5 (many diffs) n/a
6 TRCN0000481611 ACGCTCACTTGGTATTACATGAGA pLX_317 27.6% 45.2% 42.6% V5 (many diffs) n/a
Download CSV