Transcript: Human XM_017000123.2

PREDICTED: Homo sapiens tudor and KH domain containing (TDRKH), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRKH (11022)
Length:
3032
CDS:
178..1863

Additional Resources:

NCBI RefSeq record:
XM_017000123.2
NBCI Gene record:
TDRKH (11022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230649 GGCGAGACAATTCGTTCTATC pLKO_005 607 CDS 100% 10.800 15.120 N TDRKH n/a
2 TRCN0000218001 GTACACAAAGGATACGCAATT pLKO_005 1636 CDS 100% 10.800 15.120 N TDRKH n/a
3 TRCN0000230648 GCCGGCAAGGAGCCAATATTA pLKO_005 383 CDS 100% 15.000 10.500 N TDRKH n/a
4 TRCN0000218287 ACCTTGAAGATGACTACTTAC pLKO_005 1838 CDS 100% 10.800 7.560 N TDRKH n/a
5 TRCN0000184470 GCTTCCATGTCTGGTGATGAT pLKO.1 1816 CDS 100% 4.950 3.465 N TDRKH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07728 pDONR223 100% 99.8% 99.6% None 61C>T;770G>C n/a
2 ccsbBroad304_07728 pLX_304 0% 99.8% 99.6% V5 61C>T;770G>C n/a
3 TRCN0000477584 GACGGACCTTACCTGACTGCAGCA pLX_317 22.7% 99.8% 99.6% V5 61C>T;770G>C n/a
Download CSV