Transcript: Human XM_017000178.1

PREDICTED: Homo sapiens antizyme inhibitor 2 (AZIN2), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AZIN2 (113451)
Length:
1874
CDS:
596..1525

Additional Resources:

NCBI RefSeq record:
XM_017000178.1
NBCI Gene record:
AZIN2 (113451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344902 GCAAATTGCACAGATCAAATA pLKO_005 453 5UTR 100% 13.200 9.240 N AZIN2 n/a
2 TRCN0000078516 ACCATCGTGTACCACCTTGAT pLKO.1 1082 CDS 100% 4.950 3.465 N AZIN2 n/a
3 TRCN0000333782 ACCATCGTGTACCACCTTGAT pLKO_005 1082 CDS 100% 4.950 3.465 N AZIN2 n/a
4 TRCN0000078517 CTGTAAGCAAATTGCACAGAT pLKO.1 447 5UTR 100% 4.950 3.465 N AZIN2 n/a
5 TRCN0000078515 GCCATAGTGAGGAAGCACTTT pLKO.1 247 5UTR 100% 4.950 3.465 N AZIN2 n/a
6 TRCN0000078513 GCCTCAGAGATGCATCTGGGA pLKO.1 1560 3UTR 100% 0.220 0.154 N AZIN2 n/a
7 TRCN0000333863 GCCTCAGAGATGCATCTGGGA pLKO_005 1560 3UTR 100% 0.220 0.154 N AZIN2 n/a
8 TRCN0000078514 GCTGAGCTTTGACAATGAGAT pLKO.1 498 5UTR 100% 4.950 2.970 N AZIN2 n/a
9 TRCN0000333862 GCTGAGCTTTGACAATGAGAT pLKO_005 498 5UTR 100% 4.950 2.970 N AZIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04649 pDONR223 100% 67.1% 67.1% None 0_1ins453 n/a
2 ccsbBroad304_04649 pLX_304 0% 67.1% 67.1% V5 0_1ins453 n/a
3 TRCN0000492272 CACACAGCCCCATTCCCGTTGGGC pLX_317 28.5% 67.1% 67.1% V5 0_1ins453 n/a
Download CSV