Transcript: Human XM_017000287.2

PREDICTED: Homo sapiens leucine rich repeats and IQ motif containing 3 (LRRIQ3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRIQ3 (127255)
Length:
1111
CDS:
150..1079

Additional Resources:

NCBI RefSeq record:
XM_017000287.2
NBCI Gene record:
LRRIQ3 (127255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153671 CGCTGGATCATCATGTGATTT pLKO.1 607 CDS 100% 13.200 9.240 N LRRIQ3 n/a
2 TRCN0000150760 GAAGTTCAATGGCCTTCATTT pLKO.1 248 CDS 100% 13.200 9.240 N LRRIQ3 n/a
3 TRCN0000151749 CATGAAGAATGGAGTCACTAT pLKO.1 186 CDS 100% 4.950 3.465 N LRRIQ3 n/a
4 TRCN0000150323 CTTGCATCTCTCTTAGAGTAT pLKO.1 292 CDS 100% 4.950 3.465 N LRRIQ3 n/a
5 TRCN0000153050 GCCCTCACTATGTTTGATTGT pLKO.1 525 CDS 100% 4.950 3.465 N LRRIQ3 n/a
6 TRCN0000152056 CCTGAAAGATTCAAAGCATGT pLKO.1 660 CDS 100% 4.050 2.835 N LRRIQ3 n/a
7 TRCN0000152259 CATCTCTCTTAGAGTATGCAT pLKO.1 296 CDS 100% 3.000 2.100 N LRRIQ3 n/a
8 TRCN0000153140 GCATCTCTCTTAGAGTATGCA pLKO.1 295 CDS 100% 3.000 2.100 N LRRIQ3 n/a
9 TRCN0000152755 GTGTATTATCTGCCTGTCCAA pLKO.1 496 CDS 100% 2.640 1.848 N LRRIQ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13125 pDONR223 100% 63.1% 62.1% None (many diffs) n/a
2 ccsbBroad304_13125 pLX_304 0% 63.1% 62.1% V5 (many diffs) n/a
3 TRCN0000479115 TTGGGTACTTATATCCACCCCCAT pLX_317 75.6% 63.1% 62.1% V5 (many diffs) n/a
Download CSV