Transcript: Human XM_017000297.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 14 (DNAH14), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH14 (127602)
Length:
15206
CDS:
1447..15183

Additional Resources:

NCBI RefSeq record:
XM_017000297.1
NBCI Gene record:
DNAH14 (127602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268617 GTATCGGCTCATACTGCTAAA pLKO_005 2032 CDS 100% 10.800 15.120 N DNAH14 n/a
2 TRCN0000268616 GCTTGGTTGGCAAACTATATT pLKO_005 1863 CDS 100% 15.000 10.500 N DNAH14 n/a
3 TRCN0000268615 GAGACTCAACCAGCTGAAATA pLKO_005 1570 CDS 100% 13.200 9.240 N DNAH14 n/a
4 TRCN0000268661 GCAATTCAGAAGATTACTTTA pLKO_005 1921 CDS 100% 13.200 9.240 N DNAH14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13131 pDONR223 100% 9.5% 9.5% None 1_45del;1359_13734delinsG n/a
2 ccsbBroad304_13131 pLX_304 0% 9.5% 9.5% V5 1_45del;1359_13734delinsG n/a
3 TRCN0000474222 GACTCCGTATCCCGATTCGTATAC pLX_317 43.3% 9.5% 9.5% V5 1_45del;1359_13734delinsG n/a
Download CSV