Transcript: Human XM_017000338.1

PREDICTED: Homo sapiens collagen type XVI alpha 1 chain (COL16A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL16A1 (1307)
Length:
5293
CDS:
361..5142

Additional Resources:

NCBI RefSeq record:
XM_017000338.1
NBCI Gene record:
COL16A1 (1307)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108321 CGACTTTGTGTCCTGCATCTT pLKO.1 813 CDS 100% 4.950 6.930 N COL16A1 n/a
2 TRCN0000108324 GCAAATGGGTATCCACAGATA pLKO.1 733 CDS 100% 4.950 6.930 N COL16A1 n/a
3 TRCN0000303850 CATCAGACAAGAGATCATTAA pLKO_005 4653 CDS 100% 13.200 9.240 N COL16A1 n/a
4 TRCN0000303849 ATGAGCTCATTGAGATCAATC pLKO_005 1142 CDS 100% 10.800 7.560 N COL16A1 n/a
5 TRCN0000108322 CCTGAAGGGTTCCAGAACTTT pLKO.1 1900 CDS 100% 5.625 3.938 N COL16A1 n/a
6 TRCN0000300062 CCTGAAGGGTTCCAGAACTTT pLKO_005 1900 CDS 100% 5.625 3.938 N COL16A1 n/a
7 TRCN0000108323 CCAGAAGACGTGGTATCTGTT pLKO.1 699 CDS 100% 4.950 3.465 N COL16A1 n/a
8 TRCN0000108320 CGTTGGGAATAAATGGCCAAA pLKO.1 5174 3UTR 100% 4.050 2.835 N COL16A1 n/a
9 TRCN0000299992 CGTTGGGAATAAATGGCCAAA pLKO_005 5174 3UTR 100% 4.050 2.835 N COL16A1 n/a
10 TRCN0000303848 ATGGGAGACATGGTGAATTAT pLKO_005 4615 CDS 100% 15.000 9.000 N COL16A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.