Transcript: Human XM_017000417.2

PREDICTED: Homo sapiens family with sequence similarity 78 member B (FAM78B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM78B (149297)
Length:
9174
CDS:
541..1326

Additional Resources:

NCBI RefSeq record:
XM_017000417.2
NBCI Gene record:
FAM78B (149297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172928 GAGACCAAAGTTTCACGACCT pLKO.1 1034 CDS 100% 2.160 3.024 N FAM78B n/a
2 TRCN0000172905 GCCACTGCTCACAAGAATCAA pLKO.1 1011 CDS 100% 5.625 3.938 N FAM78B n/a
3 TRCN0000172339 CCAACAAGATCTCCAGGTTCT pLKO.1 923 CDS 100% 4.050 2.835 N FAM78B n/a
4 TRCN0000172832 GAACACCACCACAAAGGAGAA pLKO.1 1068 CDS 100% 4.050 2.835 N FAM78B n/a
5 TRCN0000168067 CAAACAGAGTTTCTGAGCCAA pLKO.1 1402 3UTR 100% 2.640 1.848 N FAM78B n/a
6 TRCN0000168734 GAAGATCATTCTGCAGACCAT pLKO.1 1086 CDS 100% 2.640 1.848 N FAM78B n/a
7 TRCN0000180966 GATGGAGTTCTTCAACACCTA pLKO.1 768 CDS 100% 2.640 1.848 N Fam78b n/a
8 TRCN0000172942 GAGAACATCGTGGTGTACGAT pLKO.1 586 CDS 100% 0.300 0.210 N FAM78B n/a
9 TRCN0000167547 GAATCAAGAGAGACCAAAGTT pLKO.1 1025 CDS 100% 5.625 3.375 N FAM78B n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8086 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09661 pDONR223 100% 99.8% 100% None 366G>C n/a
2 ccsbBroad304_09661 pLX_304 0% 99.8% 100% V5 366G>C n/a
3 TRCN0000477892 AAATTTCACGTCACTCGCACAGCT pLX_317 48.6% 99.8% 100% V5 366G>C n/a
Download CSV