Transcript: Human XM_017000468.2

PREDICTED: Homo sapiens dihydrolipoamide branched chain transacylase E2 (DBT), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DBT (1629)
Length:
4044
CDS:
804..1709

Additional Resources:

NCBI RefSeq record:
XM_017000468.2
NBCI Gene record:
DBT (1629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221425 GCAGGGTTTGATTGTCCCTAA pLKO.1 1313 CDS 100% 4.050 5.670 N DBT n/a
2 TRCN0000221427 CCTTCATTCAAGTATAGTCAT pLKO.1 387 5UTR 100% 4.950 3.960 N DBT n/a
3 TRCN0000319135 CCTTCATTCAAGTATAGTCAT pLKO_005 387 5UTR 100% 4.950 3.960 N DBT n/a
4 TRCN0000221423 CCAGTGATAATGCCACCTGAA pLKO.1 1491 CDS 100% 4.050 3.240 N DBT n/a
5 TRCN0000319138 CCAGTGATAATGCCACCTGAA pLKO_005 1491 CDS 100% 4.050 3.240 N DBT n/a
6 TRCN0000221426 GCTGCTTCCTTGGGATTACTA pLKO.1 1200 CDS 100% 5.625 3.938 N DBT n/a
7 TRCN0000319137 GCTGCTTCCTTGGGATTACTA pLKO_005 1200 CDS 100% 5.625 3.938 N DBT n/a
8 TRCN0000221424 CCAAGAGATAAAGGGCCGAAA pLKO.1 749 5UTR 100% 4.050 2.835 N DBT n/a
9 TRCN0000319136 CCAAGAGATAAAGGGCCGAAA pLKO_005 749 5UTR 100% 4.050 2.835 N DBT n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2019 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2020 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2186 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.