Transcript: Human XM_017000481.1

PREDICTED: Homo sapiens lymphocyte expansion molecule (LEXM), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LEXM (163747)
Length:
2273
CDS:
55..1242

Additional Resources:

NCBI RefSeq record:
XM_017000481.1
NBCI Gene record:
LEXM (163747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172847 GCAGCGATATCGATCCCTATT pLKO.1 1164 CDS 100% 10.800 15.120 N LEXM n/a
2 TRCN0000172693 GAAGGGTAACCCATACACCAA pLKO.1 567 CDS 100% 2.640 2.112 N LEXM n/a
3 TRCN0000172848 GATCCCTATTCCTGAGTGGAT pLKO.1 1175 CDS 100% 2.640 2.112 N LEXM n/a
4 TRCN0000414117 ACTTAACTCACATCACAATAA pLKO_005 864 CDS 100% 13.200 9.240 N LEXM n/a
5 TRCN0000172740 GCCCAGGGAACTGATGAATTT pLKO.1 825 CDS 100% 13.200 9.240 N LEXM n/a
6 TRCN0000173103 CCCTATGACACTTTCTCTGGT pLKO.1 754 CDS 100% 2.640 1.848 N LEXM n/a
7 TRCN0000173047 CCTGCCAGATGATTATGGGAA pLKO.1 1079 CDS 100% 2.640 1.848 N LEXM n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2214 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09753 pDONR223 100% 95.2% 95.1% None 376G>T;1185_1185delGins58 n/a
2 ccsbBroad304_09753 pLX_304 0% 95.2% 95.1% V5 376G>T;1185_1185delGins58 n/a
3 TRCN0000479796 AATGACCCTTATCGACGATTTGGC pLX_317 27.8% 95.2% 95.1% V5 376G>T;1185_1185delGins58 n/a
Download CSV