Transcript: Human XM_017000582.1

PREDICTED: Homo sapiens erythrocyte membrane protein band 4.1 (EPB41), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPB41 (2035)
Length:
6419
CDS:
203..3190

Additional Resources:

NCBI RefSeq record:
XM_017000582.1
NBCI Gene record:
EPB41 (2035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083545 CGGCCTAGTGAATGGGATAAA pLKO.1 2192 CDS 100% 13.200 18.480 N EPB41 n/a
2 TRCN0000083547 CCTTCTGGTTTACAAAGATAA pLKO.1 1354 CDS 100% 13.200 9.240 N EPB41 n/a
3 TRCN0000446631 CGCGTCTCTCCCTAGTCTTAT pLKO_005 3615 3UTR 100% 13.200 9.240 N EPB41 n/a
4 TRCN0000414323 GGACTTGGAAGGAGTAGATAT pLKO_005 1309 CDS 100% 13.200 9.240 N EPB41 n/a
5 TRCN0000083543 GCTGAGAATGTAGTATTGTTT pLKO.1 3798 3UTR 100% 5.625 3.938 N EPB41 n/a
6 TRCN0000083544 GCAGCTAAGAAATTATGGAAA pLKO.1 1511 CDS 100% 4.950 3.465 N EPB41 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4740 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4740 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10801 pDONR223 100% 56.8% 56.8% None (many diffs) n/a
2 ccsbBroad304_10801 pLX_304 0% 56.8% 56.8% V5 (many diffs) n/a
Download CSV