Transcript: Human XM_017000731.1

PREDICTED: Homo sapiens kinesin family member 21B (KIF21B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF21B (23046)
Length:
5234
CDS:
129..4874

Additional Resources:

NCBI RefSeq record:
XM_017000731.1
NBCI Gene record:
KIF21B (23046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245874 GGCTGCTTCGAGGGCTATAAT pLKO_005 348 CDS 100% 15.000 21.000 N KIF21B n/a
2 TRCN0000257703 ATGGAGCTGATGGAGTATAAG pLKO_005 1149 CDS 100% 13.200 9.240 N KIF21B n/a
3 TRCN0000257749 GTTCAGTGGCTCCCGAGATAA pLKO_005 4511 CDS 100% 13.200 9.240 N KIF21B n/a
4 TRCN0000245873 ATCGAGGAGCTACGGACTAAG pLKO_005 1413 CDS 100% 10.800 7.560 N KIF21B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11664 pDONR223 100% 95.4% 94.8% None (many diffs) n/a
2 ccsbBroad304_11664 pLX_304 0% 95.4% 94.8% V5 (many diffs) n/a
3 TRCN0000478126 TGCCAAGACCTCGTCTTCATATTG pLX_317 8.6% 95.4% 94.8% V5 (many diffs) n/a
Download CSV