Transcript: Human XM_017000756.2

PREDICTED: Homo sapiens ral guanine nucleotide dissociation stimulator like 1 (RGL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGL1 (23179)
Length:
4196
CDS:
71..2122

Additional Resources:

NCBI RefSeq record:
XM_017000756.2
NBCI Gene record:
RGL1 (23179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048064 CCACCATCTCTCAGTTTAATA pLKO.1 903 CDS 100% 15.000 21.000 N RGL1 n/a
2 TRCN0000310593 CCACCATCTCTCAGTTTAATA pLKO_005 903 CDS 100% 15.000 21.000 N RGL1 n/a
3 TRCN0000303951 GAGAACCTAGTCTCGTATATT pLKO_005 2531 3UTR 100% 15.000 21.000 N RGL1 n/a
4 TRCN0000303950 TAATTCCATCTATCGGTTAAA pLKO_005 1081 CDS 100% 13.200 18.480 N RGL1 n/a
5 TRCN0000303956 GACAATGACTTTACCTATATC pLKO_005 329 CDS 100% 13.200 9.240 N RGL1 n/a
6 TRCN0000048067 CCTGTAAGATCAGGACCATAA pLKO.1 258 CDS 100% 10.800 7.560 N RGL1 n/a
7 TRCN0000048066 GCACAACTCTTCAAGAAAGTA pLKO.1 803 CDS 100% 5.625 3.938 N RGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02728 pDONR223 100% 84.4% 84% None (many diffs) n/a
2 ccsbBroad304_02728 pLX_304 0% 84.4% 84% V5 (many diffs) n/a
3 TRCN0000477017 GGCACACCGTGGTACATCTTCAGG pLX_317 16.4% 84.4% 84% V5 (many diffs) n/a
Download CSV