Transcript: Human XM_017000759.2

PREDICTED: Homo sapiens synaptotagmin 11 (SYT11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT11 (23208)
Length:
5256
CDS:
261..1565

Additional Resources:

NCBI RefSeq record:
XM_017000759.2
NBCI Gene record:
SYT11 (23208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381531 AGCATCGAGTTCCTCGTTATC pLKO_005 1395 CDS 100% 10.800 15.120 N SYT11 n/a
2 TRCN0000381021 ACTACGGCAGAAAGCGCATTG pLKO_005 1279 CDS 100% 6.000 8.400 N SYT11 n/a
3 TRCN0000001560 GCATCAGCATATACCCAGAGA pLKO.1 442 CDS 100% 2.640 3.696 N SYT11 n/a
4 TRCN0000001563 ATCCTTCCTGACAAACGGCAT pLKO.1 864 CDS 100% 2.160 3.024 N SYT11 n/a
5 TRCN0000379553 AGAACTAAGGAGCCCTATTAC pLKO_005 650 CDS 100% 13.200 10.560 N SYT11 n/a
6 TRCN0000382480 ACAGTCTGAGCGAGTACTAAT pLKO_005 1546 CDS 100% 13.200 9.240 N SYT11 n/a
7 TRCN0000379458 AGAACCCACCATACAAGTTTA pLKO_005 406 CDS 100% 13.200 9.240 N SYT11 n/a
8 TRCN0000379654 CCTAGCTCTGGATCTTGTATA pLKO_005 597 CDS 100% 13.200 9.240 N SYT11 n/a
9 TRCN0000381341 TCTCTCGGGATGATGTCATTG pLKO_005 1015 CDS 100% 10.800 7.560 N SYT11 n/a
10 TRCN0000381590 TGACCATCCTTCCTGACAAAC pLKO_005 859 CDS 100% 10.800 7.560 N SYT11 n/a
11 TRCN0000001561 ATAGACCAATTACCCATCAAA pLKO.1 615 CDS 100% 5.625 3.938 N SYT11 n/a
12 TRCN0000001562 CATCAAAGTGCGGAGAGACAA pLKO.1 485 CDS 100% 4.950 3.465 N SYT11 n/a
13 TRCN0000001559 GCCTCTTATATCTCTGCTCTT pLKO.1 2406 3UTR 100% 4.050 2.835 N SYT11 n/a
14 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 3490 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
15 TRCN0000381801 ACAGTCTGAGCGAGTACTAAC pLKO_005 1546 CDS 100% 10.800 7.560 N Syt11 n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2043 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1878 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2043 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07855 pDONR223 100% 99% 98.6% None (many diffs) n/a
2 ccsbBroad304_07855 pLX_304 0% 99% 98.6% V5 (many diffs) n/a
3 TRCN0000480526 GTTCGGGAATATTTCGAACATATA pLX_317 27.9% 99% 98.6% V5 (many diffs) n/a
4 ccsbBroadEn_10455 pDONR223 100% 99% 98.6% None (many diffs) n/a
5 ccsbBroad304_10455 pLX_304 0% 99% 98.6% V5 (many diffs) n/a
6 TRCN0000479218 CCCCCAAGGATTTAACAAATGCCT pLX_317 34.1% 99% 98.6% V5 (many diffs) n/a
Download CSV