Transcript: Human XM_017000900.1

PREDICTED: Homo sapiens mechanistic target of rapamycin kinase (MTOR), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTOR (2475)
Length:
8184
CDS:
266..7234

Additional Resources:

NCBI RefSeq record:
XM_017000900.1
NBCI Gene record:
MTOR (2475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195453 CAGGCCTATGGTCGAGATTTA pLKO.1 5798 CDS 100% 13.200 18.480 N MTOR n/a
2 TRCN0000197150 GTTTGAGCATGCCGTCAATAA pLKO.1 6442 CDS 100% 13.200 18.480 N MTOR n/a
3 TRCN0000232389 TATTAACAGGGTTCGAGATAA pLKO_005 7084 CDS 100% 13.200 18.480 N Mtor n/a
4 TRCN0000199323 CCCGGATCATTCACCCTATTG pLKO.1 3042 CDS 100% 10.800 15.120 N MTOR n/a
5 TRCN0000344491 CCCGGATCATTCACCCTATTG pLKO_005 3042 CDS 100% 10.800 15.120 N MTOR n/a
6 TRCN0000038676 CCTCCTATTGTTAAGTTGTTT pLKO.1 2930 CDS 100% 5.625 7.875 N MTOR n/a
7 TRCN0000221546 GAACCAATTATACCCGTTCTT pLKO.1 6534 CDS 100% 4.950 6.930 N MTOR n/a
8 TRCN0000038678 GCATGGAAGAATACACCTGTA pLKO.1 4167 CDS 100% 4.050 5.670 N MTOR n/a
9 TRCN0000038677 GCCAGAATCTATTCATTCTTT pLKO.1 7009 CDS 100% 0.563 0.788 N MTOR n/a
10 TRCN0000038674 CCGCTAGTAGGGAGGTTTATT pLKO.1 7848 3UTR 100% 15.000 12.000 N MTOR n/a
11 TRCN0000221545 GCCTTGTTTGTGGCTCTGAAT pLKO.1 1667 CDS 100% 4.950 3.960 N MTOR n/a
12 TRCN0000332887 GCCTTGTTTGTGGCTCTGAAT pLKO_005 1667 CDS 100% 4.950 3.960 N MTOR n/a
13 TRCN0000221542 GCTGCTGTTGAAGAATATATT pLKO.1 7402 3UTR 100% 15.000 10.500 N MTOR n/a
14 TRCN0000360707 ATGCTGTCCCTGGTCCTTATG pLKO_005 1208 CDS 100% 10.800 7.560 N Mtor n/a
15 TRCN0000196655 GCAGAAATGTTTGCAAGATAG pLKO.1 7749 3UTR 100% 10.800 7.560 N MTOR n/a
16 TRCN0000221544 GCTGTGCTACACTACAAACAT pLKO.1 4982 CDS 100% 5.625 3.938 N MTOR n/a
17 TRCN0000332888 GCTGTGCTACACTACAAACAT pLKO_005 4982 CDS 100% 5.625 3.938 N MTOR n/a
18 TRCN0000221543 GCAACCCTTCTTTGACAACAT pLKO.1 145 5UTR 100% 4.950 3.465 N MTOR n/a
19 TRCN0000363722 GCAACCCTTCTTTGACAACAT pLKO_005 145 5UTR 100% 4.950 3.465 N MTOR n/a
20 TRCN0000197118 GTTTAGAGCAAGGGCTCAGAA pLKO.1 7987 3UTR 100% 4.950 3.465 N MTOR n/a
21 TRCN0000038675 CCTGGCAACAATAGGAGAATT pLKO.1 1978 CDS 100% 0.000 0.000 N MTOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.